Β-пропеллерная фитаза bacillus ginsengihumi: клонирование гена, очистка белка, свойства фермента 03. 02. 03 -микробиология



Скачать 400.59 Kb.
Дата12.08.2016
Размер400.59 Kb.
ТипАвтореферат
На правах рукописи

АХМЕТОВА АЛИНА ИЛЬДУСОВНА



β-ПРОПЕЛЛЕРНАЯ ФИТАЗА BACILLUS GINSENGIHUMI: КЛОНИРОВАНИЕ ГЕНА, ОЧИСТКА БЕЛКА, СВОЙСТВА ФЕРМЕНТА

03.02.03 –микробиология


АВТОРЕФЕРАТ
диссертации на соискание ученой степени

кандидата биологических наук

Казань – 2013

Работа выполнена в лаборатории биосинтеза и биоинженерии ферментов кафедры микробиологии Института фундаментальной медицины и биологии ФГАОУВПО «Казанский (Приволжский) федеральный университет»


Научный руководитель: д.б.н. проф. Шарипова Маргарита Рашидовна
Официальные оппоненты: д.б.н. Дегтярева Ирина Александровна, Государственное научное учреждение Татарский научно-исследовательский институт агрохимии и почвоведения Россельхозакадемии, заведующий лабораторией

к.б.н. Куликов Сергей Николаевич, Федеральное бюджетное учреждение науки «Казанский научно-исследовательский институт эпидемиологии и микробиологии» Роспотребнадзора, ведущий научный сотрудник

Ведущая организация: Государственное научное учреждение Татарский Научно-исследовательский институт сельского хозяйства Российской академии сельскохозяйственных наук, г.Казань
Защита диссертации состоится «26» декабря 2013г. в 13.00 ч на заседании диссертационного совета Д.212.081.08 при ФГАОУВПО «Казанский (Приволжский) федеральный университет» по адресу: 420008, г. Казань, ул. Кремлевская, 18, главное здание, аудитория №211.
С диссертацией можно ознакомиться в научной библиотеке им. Н.И. Лобачевского Казанского (Приволжского) федерального университета по адресу: 420008, г. Казань, ул. Кремлевская, 35.
Автореферат разослан «___» ноября 2013 г.
Ученый секретарь

диссертационного совета,

доктор биологических наук, профессор З. И. Абрамова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы

Значительную долю в рационах моногастричных животных занимают пшеница, ячмень, рожь и другие зерновые культуры, обладающие не только питательными, но и отрицательными свойствами (Tran J. Ind. Microbiol. Biotechnol., 2010). В злаках, бобовых и семенах масличных культур содержится фитиновая кислота, которая связывает фосфор и делает корма на 70-80% недоступными для переваривания животными. Это ограничивает использование перечисленных культур в кормлении и, особенно, при разработке высоко - концентрированных рационов для интенсивного выращивания животных и птицы (Ramesh A., Indian J. Microbiol, 2011). Фитиновая кислота - это специфическое химическое соединение шестиатомного спирта инозитола, по гидроксильным радикалам которого связано 6 остатков фосфорной кислоты (Kumar V., World J. Microbiol. Biotechnol., 2013). Остатки фосфорной кислоты химически активны и связывают ионы металлов – кальций, натрий, калий, цинк, медь. Фитиновая кислота также взаимодействует с остатками аминокислот, переводя их в недоступное для растений и бактерий состояние. Соли фитиновой кислоты - фитаты - составляют почти 50% от общего органического фосфора и более 80% от общего фосфора в кормах растительного происхождения (Ramesh A., Indian J. Microbiol, 2011).

Переводить фитаты в доступное состояние путем высвобождения фосфатов способны бактерии. Они гидролизуют эти соединения с помощью ферментов – фитаз (Coban H., Bioprocess Biosyst Eng., 2013). Это особая группа фосфомоноэстераз, способных гидролизовать фитат на более доступные фосфатсодержащие соединения. Фитазы практически не вырабатываются в пищеварительном тракте свиней, птицы и других животных с однокамерным желудком (Jorquera M., FEMS Microbiol Ecol., 2012). Как правило, в условиях низкой активности или полного отсутствия фитаз фитиновый фосфор и связанные с ним полезные питательные вещества, проходят желудочно-кишечный тракт транзитом (George T., FEMS Microbiol Ecol., 2009).

Существует острая необходимость в разработке новых наукоемких биотехнологий, основанных на использовании бактериальных ферментов, которые могут служить кормовыми добавками для утилизации фитатов. Поэтому вопросы, связанные с поиском микроорганизмов-продуцентов фитат-гидролизующих ферментов, получением этих белков, изучением структуры и свойств микробных фитаз, а также созданием на их основе новых биотехнологий являются актуальным и направлены на решение этой проблемы.



Цель работы – изоляция и характеристика штаммов бацилл обладающих фитат-гидролизующей активностью, клонирование гена фитазы, очистка белка и изучение его свойств.

Основные задачи исследования:



  1. Поиск и выделение грамположительных микроорганизмов, обладающих фитат-гидролизующей активностью, в образцах почв республики Татарстан.

  2. Клонирование и секвенирование гена фитазы штамма изолята, получение рекомбинантного штамма с высокой активностью фермента.

  3. Разработка метода выделения и очистки фитазы B.ginsengihumi М2.11, установление первичной структуры и свойств фермента.

  4. Определение токсичности и биологических свойств B.ginsengihumi М2.11 – продуцента фитазы.

Научная новизна

Впервые из образцов почв республики Татарстан изолирован штамм B.ginsengihumi М2.11 с высокой фитат-гидролизующей активностью, клонирован ген фермента и установлена его последовательность. Получен эффективный вектор экспрессии с геном фитазы B.ginsengihumi М2.11 и рекомбинантный штамм, позволяющий получать белок в препаратных количествах. Разработан метод очистки бациллярной фитазы, включающий аффинную, ионообменную хроматографию и гель-фильтрацию. Установлена первичная структура фитазы B.ginsengihumi М2.11. Фермент принадлежит к классу β-пропеллерных фосфатаз с молекулярной массой 41 кДа, изоэлектрической точкой pI 4.8.Полученные данные о свойствах фермента пополняют знания о β-пропеллерных фитазах бацилл.



Практическая значимость результатов

Выделенный из образцов почв республики Татарстан штамм B.ginsengihumi М2.11 обладает фитат-гидролитической активностью, не токсичен и оказывает стимулирующее влияние на рост и развитие картофеля и может быть использован в сельском хозяйстве как биоудобрение, стимулирующее рост и развитие растений, а также в качестве кормовой добавки в животноводстведля повышения продуктивности. Разработанный метод очистки фитазы B.ginsengihumi М2.11 может служить основой для его использования в биотехнологии растений и сельском хозяйстве.



Связь работы с научными программами.

Работа выполнена в соответствии с планом НИР Казанского (Приволжского) федерального университета (№ гос. регистрации 01:02.00 104982 «Биосинтез, биогенез, классификация, физиологические функции новых микробных ферментов и возможные области их практического применения»). Исследования выполнены при поддержке грантов для молодых ученых от Академии наук республики Татарстан №13-20/Г-2010 и №13-24/2011, грантовГерманской службы академических обменов DAAD по программе «Евгений Завойский» № A/10/85937 и № A/12/71727,гранта РФФИ 12-08-00942а, Федеральной целевой программы «Научные и научно-педагогические кадры инновационной России» 2009-2013 гг.: ГК № П344, ГК № П406, ГК № П323, ГК № 815, ГК № 1053, соглашения №14.132.21.1786 и 14.A18.21.0575.



Положения, выносимые на защиту:

  1. Изолирован и идентифицирован новый продуцент фитазы B.ginsengihumi М2.11, ген фермента клонирован и секвенирован, белок очищен, классифицирован как β-пропеллерная фосфатаза, изучены энзиматические свойства фермента.

  2. Штамм B.ginsengihumi M2.11– продуцент фитазы - не токсичен в отношении растений и стимулирует их рост и развитие.

Апробация работы

Основные положения диссертации представлены на международных научных конференциях: IV Российский симпозиум «Белки и пептиды» Казань, 2009), научно-практическая конференция биохимиков, посвященная памяти профессора В.Г.Винтера «История и достижения Казанской биохимической школы» Казань, 2009), XIII annual Symposium for Biology Students of Europe “SymBioSE 2009” “Biology: Expansion of Borders” (Казань, 2009), XIII annual Symposium for Biology Students of Europe “SymBioSE 2009” “Biology: Expansion of Borders” Эскишехир, Турция, 2010), на российской школе молодых ученых «Актуальные проблемы современной биохимии и молекулярной биологии» (Казань, 2010), XV annual Symposium for Biology Students of Europe “SymBioSE 2011”, (Базель, Швейцария, 2011), “Students, Masters and PhD Students III Annual International Scientific Conference in Biology” dedicated to the Academician Peter Kometiani (Тбилиси, Грузия, 2011), XIX Международной молодежной научной конференции студентов, аспирантов и молодых ученых «Ломоносов» (Москва, 2012), XVI annual Symposium for Biology Students of Europe “SymBioSE 2012” (Szeged, Hungary, 2012), открытом конкурсе научных работ студентов и аспирантов им. Н.И. Лобачевского (Казань, 2012), международном конкурсе 2012 года «Russia Graduate competition for Alltech’s Young Scientist Award», III Международной научно-практической конференции «Постгеномные методы анализа в биологии, лабораторной и клинической медицине» (Казань, 2012), XX Международной молодежной научной конференции студентов, аспирантов и молодых ученых «Ломоносов» (Москва, 2013), IV Российский симпозиум «Белки и пептиды» (Уфа, 2013), Federation of European Biochemical Societies CONGRESS 2013 “Mechanisms in Biology” (FEBS) (Санкт-Петербург, 2013).



Публикации. По материалам диссертации опубликовано 28 научных работ, в том числе6 статей в рецензируемых журналах, рекомендованных ВАК для публикации материалов диссертации, 1 учебно-методическое пособие.

Благодарности. Автор выражает глубокую признательность своему научному руководителю д.б.н., профессору кафедры микробиологии М.Р. Шариповой за постановку проблемы, внимательное отношение к работе и обсуждение полученных результатов; к.б.н., доц. А.М. Мардановой и к.б.н., с.н.с. Н.П. Балабан за постоянные консультации и обсуждение результатов; профессору Удо Хайнеманну за научные консультации по фитазам микроорганизмов, а также за возможность проведения исследований на базе Института Молекулярной Медицины Макса Дельбрука г. Берлин, Германия; профессору Фикреттину Шахину за сотрудничество и возможность проведения экспериментов по утилизации труднодоступных соединений в лаборатории университета Йедитепе г. Стамбул, Турция. Автор выражает искреннюю благодарность заведующей кафедрой микробиологии Казанского федерального университета д.б.н., профессору, академику АН РТ О.Н. Ильинской и всем сотрудникам кафедры за всестороннюю помощь и поддержку.

Структура и объём диссертации. Диссертация включает разделы: введение, обзор литературы, материалы и методы, результаты исследований, обсуждение результатов, выводы и список литературы. Работа изложена на 105 страницах машинописного текста, содержит 9 таблиц и 45 рисунков. Библиография содержит 84 наименований российских и зарубежных авторов.
МАТЕРИАЛЫ И МЕТОДЫ

Отбор и скрининг почвенных образцов. Отбор образцов почв проводили на различных территориях республики Татарстан в сентябре 2009: государственного унитарного предприятия агрокомбината «Майский» г. Казань, Казанского совхоза «Тепличный», лесной зоны д. Агерзе Азнакаевского района, приусадебного хозяйства с. Нижний Услон, придворовой зоны Казанского (Приволжского) федерального университета. Учет микроорганизмов проводили методом посева на среду PSM с фитатом натрия в качестве единственного источника фосфора.

Питательные среды и условия культивирования. Селекцию фитат-гидролизующих штаммов микроорганизмов проводили на фитат-содержащей среде PSM (Phytase Screening Medium) (Sasirekha, Euro. J. Exp. Bio., 2012).Культивирование бактерий проводили на среде LB (Sambrook and Russell, 2001). Для индукции эспрессии гена фитазы рекомбинантного штамма использовали среду на основе насыщенного бульона TB (Terrific Broth) (Geerlof A., Helmholtz Center Munich Protocols, 2010), а также использовали коммерческую экспресс-среду TB (Overnight Express Instant TB Medium, Novagen) (Scheich C., Nucleic Acids Res., 2007). Для изучения влияния бактерий на рост растений использовали соевую агаризованную среду на основе триптона TSA (Tryptic Soy Agar) (Leavitt J., The NY J. Dentist., 1955).

Штаммы бактерий и плазмиды. В работе использовали штаммы: E. coli XLI-Blue, E. coli DH5α, E.coli Rosseta 2 (DE3) Т1R; плазмиды: pTZ57R/T; pQlinkH, pQLinkG и pET-46 (с His-tag). Штамм Xanthomonas sp. Xav5 использовали в тесте на определение токсичности в качестве контрольного фитопатогенного микроорганизма.

Микробиологическая система идентификации (Microbial Identification System,Version 6.2) Родовую принадлежность микроорганизмов определяли с помощью системы микробной идентификации на основе газохроматографического анализа метиловых эфиров жирных кислот клеточной мембраны бактерии. 20 часовую культуру бактерий собирали с агаризованной среды LB и помещали в пробирку. Выделяли фракцию эфиров для анализа как описано в методике (MIS Operating Manual, Version 6.2, 2012) Фракции помещали в хроматографические колонки и устанавливали в анализатор (Agilent GC 78900 Series).

Идентификацию микроорганизмов проводили на основе анализа последовательности гена 16S рРНК с использованием стандартных праймеров: 27F (5’ GAGTTTGATCCTGGCTCAG 3’) и 1525R (5’ ACGGTTACCTTGTTACGACTT 3’).

Активность фитазы определяли по количеству высвободившегося фосфора при гидролизе фитатанатрия по методу Грайнера (Greiner R., Can.J. Microbiol, 2007). За единицу активности принимали количество фермента, гидролизующего в условиях эксперимента 1 мМ субстрата за 1 мин.

Выделение ДНК из клеток бацилл проводили с помощью реактивов «GeneJet Genomic DNA Purification Kit», «GeneJET Plasmid Miniprep Kit» («Fermentas») согласно прилагаемому протоколу.

Клонирование гена phyBg в плазмиду pET-LIC проводили с помощью праймеров, содержащих комплиментарные нуклеотиды для отжига, старт -, стоп-кодоны и последовательности, кодирующие Нis-tag на N-конце. Амплификат гена фитазы клонировали в вектор pET-46LIC, который трансформировали в компетентные клетки E.coliDH5α. Анализ рекомбинантных плазмид проводили с помощью ферментов рестрикции BamHI и NotI, ПЦР-реакции. Вектор pET-LIC/Phy трансформировали в коммерческий штамм-реципиент E.coli Rosseta 2 (DE3) Т1R. Трансформанты выращивали на селективной среде ТВ с хлорамфениколом и карбоницилином (100 мг/мл).

Рестрикционное картирование ДНК проводили набором рестриктаз фирмы «Fermentas» в течение 2 ч при 37°С в условиях, рекомендованных производителем.

Лигирование ДНК проводили при температуре 40С в течение ночи в 30 мкл реакционной смеси, содержащей 3 мкл лигазного буфера и 5 ед. акт. лигазы Т4 («Сибэнзим») на 1 мкг ДНК.

Трансформацию клеток E.coli плазмидной ДНК проводили как описано в работе (Sambrook et al., 1989).

Выделение ДНК из агарозного геля осуществляли с помощью набора реактивов “Gel Extraction kit” (Fermentas).

Полимеразную цепную реакцию (ПЦР) проводили в термоциклере «MJ mini» производства фирмы «BioRad» (США) с использованием Pfu-полимеразы и Taq-полимеразы фирмы «Сибэнзим», как описано (Sambrook J., Molecular Cloning, 1989).

Электрофорез проводили в горизонтальном агарозном геле (1%).

Иммуноблоттинг. Клетки рекомбинантного штамма разрушали с помощью ультразвука (20-50 кГц). Лизаты разделяли в SDS-ПААГ как описано в (Sambrook J., MolecularCloning, 2001). Western blot проводили как описано в методике (Sambrook J., MolecularCloning, 2001).

СеквенированиеДНК осуществляли в фирме «Синтол», г.Москва.

Выделение и очистку белка проводили из клеток рекомбинантного штамма E.coli Rosseta pET-LIC/Phy, разрушенных с помощью френч-прессав буфере, содержащем 50 мМ Трис-HCl, pH 8.0, протеиназу, 1 мг/мл (Fermentas) и ДНКазу, 1 мг/мл (Fermentas). Для очистки использовали аффинную хроматографию на основе Ni-гранул в 25 мМ Трис-HCl буфере, рН 8.0, хроматографию на Q – Sepharose в 25 мМ Трис-HCl, рН 8.0буфере и гель-фильтрацию белка на колонке Sephadex G200, уравновешенной 10 мМ Hepes буфером, рН7.5 с добавлением 5 мМ CaCl2. Степень чистоты препаратов и молекулярную массу определяли методом электрофореза в 12.5%-ном ПААГ в присутствии SDS по методу Лаэммли (Laemmli U., Nature, 1970).

Белок определяли спектрофотометрически, считая, что концентрация белка 1 мг/мл соответствует А280 = 1 оптической единице (опт. ед.) в кювете толщиной 1 см, а также по методу Брэдфорда (Bradford M., Analyt. Biochem, 1976).
рН-оптимум и рН-стабильность

рН-Оптимум фермента определяли по гидролизу фитата натрия в 0.1М натрий ацетатном буфере, pН 5.0- 5.5, 0.1М трис-малатном буфере, рН 6.0– 7.0 и в 0.1 М трис-HCl буфере рН 7.5 – 9.0. Для определения рН-стабильности фермент предварительно инкубировали в 0.1М буфере при рН 5.0– 9.0 в течение 24 ч при комнатной температуре и определяли активность.



Температурный оптимум и термостабильность

Температурный оптимум определяли по гидролизу фитата натрия в 0.1 М натрий ацетатном буфере рН4.5, инкубируя реакционную смесь при температурах 4, 17, 25, 30, 37, 42, 50, 60, 70, 80, 95°С. При изучении термостабильности растворы фермента предварительно инкубировали 40 мин при температурах от 4º до 95ºС и затем определяли активность фитазы.



Влияние ионов металлов на активность фитазы

Для изучения влияния ионов двухвалентных металлов на активность фитазы использовали соли: MgCl2, CoCl2, ZnCl2, CaCl2, MnSO4, FeSO4 и CuSO4 в конечной концентрации 2 мМ. К ферментному раствору добавляли растворы солей двухвалентных металлов и выдерживали при комнатной температуре в течение 30 мин, затем определяли активность фермента по гидролизу фитата натрия и выражали в процентах относительно контроля. Контролем (100%) служил уровень активности фермента в отсутствие ионов металлов.



Субстратную специфичность фитазы определяли по гидролизу фосфорилированных субстратов в концентрации 3мМ: фитат натрия, нитрофенилфосфат, глицерофосфат, глюкозо-6-фосфат, аденозинтрифосфата (АТФ).

Масс-спектрометрический анализ (MALDI-TOF). Ферментобрабатывали трипсином по методике, изложенной на сайте (http://www.bioc.uzh.ch). Пептиды различной молекулярной массы идентифицировали на масс-спектрометре Vision 2000 TOF («Thermo Bioanalysis», Великобритания). Данные обрабатывали с помощью программ PeptideMassFingerprint (http://www.matrixscience.com.) и PeptideMass (http://cn.expasy.org). Изоэлектрическую точку фермента определяли с использованием ресурса http://web.expasy.org/protparam/.

Геноинформатика

Выравнивание последовательностей проводили с использованием алгоритмов BLAST: пакета программ, представленных на сервере NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi)и биоинформационного портала ExPASy (http://www.expasy.org).



Влияние штамма B.ginsengihumi М2.11 на рост картофеля изучали по методу Эситкена (Esitken A., Scientia Horticulturae, 2010).

Определение токсичности штамма B.ginsengihumi М2.11 проводили по методу Котана (Kotan R., J. Plant Diseases and Protection, 2006). В качестве контроля использовали лабораторный штамм фитопатогенных бактерий Xanthomonas sp. Xav5.



Математическая обработка результатов

Для статистического анализа экспериментальных данных использовали программу MicrosoftExcel. Для описания и сравнения признаков использовали построения 95%-ных доверительных интервалов для средних значений.



РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ

1. Выделение изолятов фитат-гидролизующих бактерий и их характеристика

Для поиска фитат-гидролизующих микроорганизмов проводили отбор проб различных образцов почв республики Татарстан: Агрокомбината «Майский» (Казань), леса д.Агерзе Азнакаевского района, придворовой зоны КФУ, Казанского Тепличного совхоза, приусадебногохозяйства с. Нижний Услон, приусадебного хозяйства «Нармонки» Лаишевского района. На среде с фитатом из образцов почвы ГУП Агрокомбината «Майский» выделили 29 × 103 КОЕ / 1 г почвы, леса д.Агерзе Азнакаевского района –более 100 × 103 КОЕ / 1 г почвы, с образцов придворовой зоны КФУ – около 5 × 103 КОЕ / 1 г почвы, Казанского Тепличного совхоза – 0.4 × 103 КОЕ / 1 г почвы. Для работы мы отобрали 12 штаммов микроорганизмов с максимальной зоной гидролиза фитата. Изоляты высевали на фитат-содержащую среду и инкубировали при 37оС в течение 5 суток, затем проводили измерение зон гидролиза фитата (рис. 1).



p1030017

Рис.1. Рост изолированных микроорганизмов на фитат-содержащей среде.

Отобрали 5 штаммов-изолятов с максимальными зонами просветления, четыре из которых являлись грамотрицательными палочками (0.6х6 мкм). Пятый изолят М2.11 мы идентифицировали как грамположительные бактерии. Идентификацию изолятов проводили при помощи микробиологической системы идентификации (Microbial Identification System), основанной на анализе липидов цитоплазматических мембран. По результатам MIS-анализа установили, что изолированный штамм М2.11 с фитат-гидролизующей активностью является представителем рода Bacillus, идентичность состава клеточной мембраны изолята с клеточной мембраной бацилл составила 97.3%. Сравнительный анализ ПЦР - продукта гена 16S рРНК изолированного штамма позволил нам выявить высокую гомологию гена 16S рРНК с геном 16S рРНК штамма Bacillus ginsengihumi ANA12 (HQ219843.1): идентичность генов составила 97% (895 нуклеотида из 915).

Таким образом, из образцов почв республики Татарстан нами выделен грамположительный штамм B.ginsengihumi М2.11.

Клетки односуточной культуры (4-8х0.8 мкм) B.ginsengihumi М2.11 были палочковидной формы, соединены в короткие цепочки, образовывали круглые колонии с гладкой поверхностью и ровными краями,пигмент не образовывался. В процессе роста среда становилась мутной, появлялся осадок. Пленка на поверхности не образовывалась. Овальные споры штамма не превышали диаметра клеток и появлялись на 24 ч роста (не более 5%), далее их количество нарастало и достигало максимального значения (до 80%) на 42 ч культивирования (рис. 2). При определении динамики роста и накопления фитазной активности в культуральной жидкости B.ginsengihumi М2.11 установили, что активность фермента появлялась в культуральной жидкости на 6-й ч роста и сохранялась на протяжении всех фаз роста бактерий.


2

3

1
c:\users\алина\pictures\m211.png

Рис.2. Динамика роста (1), спорообразования (2) и накопления фитазной активности (3) в культуральной жидкости B.ginsengihumi М2.11.



2. Геноинформационный анализ генов фитаз

Проводили поиск и геноинформационный анализ генов, кодирующих фитазу, в геномах грамположительных бактерий рода Bacillus, представленных в базе данных NCBI. Выравнивание последовательностей генов фитаз бацилл позволило нам выявить их высокую гомологию у бацилл (рис. 3).

По данным анализа нуклеотидная последовательность гена фитазы B.subtilis (AN AJ277890.1) полностью гомологична (100%) последовательности гена фитазы B.amyloliquefaciens strain DSM 1061 (AN HM747163.1). Гомология нуклеотидной последовательности гена фитазы B.subtilis с геном фитазы B.licheniformis (AN JX187608.1) составила 76%.

c:\users\алина\pictures\vdvdv.png

Рис.3. Выравнивание последовательностей генов фитаз бацилл при помощи программы ClustalW (http://www.ch.embnet).

Сравнительный анализ структуры гена phyC Bacillus subtilis с генами фитаз грибов (Aspergillus sp.) и грамотрицательных бактерий (Pseudomonas sp., Klebsiella sp., Echerichia) не выявил гомологии. Тем не менее, мы обнаружили гомологию фитаз внутри каждого из перечисленных родов микроорганизмов. Так, структура гена фитазы A.niger (AN AY7457391) гомологична последовательностям генов фитаз A.ficuum (AN AF537344.1) и A.awamori (AN DQ192035.1) на 92%.

3. Амплификация гена фитазы и подбор оптимальный условий для полимеразной цепной реакции

На основании высокой гомологии генов мы сконструировали праймеры для клонирования гена фитазы B.ginsengihumi М2.11. Для этого использовали последовательность гена фитазы B.subtilis 168 (ANNC000964.3). Праймеры NCBI-dir и NCBI-rev подобрали с помощью программы Primer BLAST на сервере NCBI (http://www.ncbi.nlm.nih.gov/), другая пара праймеров ORF-dir и ORF-rev ограничивала полную рамку считывания гена. С помощью 2-х пар праймеров проводили амплификацию гена фитазы с ДНК B.ginsengihumi М2.11. Размер ПЦР-продукта с применением обоих пар праймеров соответствовал 1149 п.н. и представлял амплификат гена фитазы B.ginsengihumi М2.11. При оптимизации условий ПЦР выяснили, что при температуре отжига 58ºСи применении праймеров ORF-dir и ORF-rev специфичность отжига увеличивалась (рис. 4).



аии

Рис.4. Электрофорез амплификата гена фитазы с геномной ДНК B.ginsengihumi М2.11. 1. – ПЦР-продукт, полученный при использовании праймеров NCBI- dir/ NCBI-rev, 2. - ПЦР-продукт, полученный при использовании праймеров ORF-dir/ ORF-rev, М – маркеры.

Таким образом, на основании высокой гомологии генов фитазу бацилл мы сконструировали праймеры и амплифицировали ген фитазы B.ginsengihumi М2.11.

Продукт амплификации очищали и секвенировали (рис. 5). Установленная последовательность нуклеотидов амплификата гена фитазы B.ginsengihumi М2.11, полученного с помощью праймеров, ограничивающих ORF, начиналась со старт - кодона ATG и заканчивалась стоп – кодоном TAG. Выравнивание последовательности с последовательностью гена B.subtilis 168 показало 100% гомологию генов и подтвердило данные геноинформационного анализа о высокой степени консервативности генов фитаз среди представителей рода Bacillus.

Таким образом, впервые нами определена нуклеотидная последовательность гена фитазы B. ginsengihumi М2.11, показана ее высокая гомология с геном фитазы B.subtilis 168.

c:\users\алина\pictures\фитаза b.s..png

Рис.5. Нуклеотидная последовательность гена фитазы B.ginsengihumi М2.11, полученная в результате секвенирования амплификата гена. Старт- и стоп- кодоны гена подчеркнуты.



4. Получение рекомбинантного штамма

Амплификат гена фитазы B. ginsengihumi М2.11 клонировали в экспрессионный вектор pET-46 Ek/LIC по принципу LIC – клонирования (клонирование без лигазы) (рис. 6).В основе этой системы лежит использование 3'-5'-экзонуклеазнойактивности Т4 ДНК-полимеразы, которая в присутствие одного нуклеотида в реакционной цеписоздает специфические фрагменты ДНК в векторе экспрессии и ПЦР-продукте. Высокоспецифичный отжиг образованных полимеразой комплементарных фрагментов ДНК выполняли смешиванием вставки и вектора в отсутствие лигазы.



Рис.6. Схема экспрессионного вектора pET-LIC/Phy.

После трансформации вектора pET-LIC/Phy в реципиентный штамм E.coli DH5α из рекомбинантного штамма выделяли плазмиды и анализировали их на присутствие вставки (рис. 7).

c:\users\алина\pictures\пцр форез.png

Рис.7. Электрофорез ПЦР-продуктов, полученных с рекомбинантной плазмиды. М – маркер; 1-8 – амплификаты, полученные с использованием праймеров к гену phy Phy-LIC fw/rev.




А Б
ПЦР-анализ с праймерами к гену фитазы B.ginsengihumi М2.11 подтвердил наличие вставки в векторе экспрессии. Секвенирование вставки также показало присутствие гена фитазы в векторе. Вектор pET-LIC/Phy трансформировали в коммерческий беспротеазный штамм Escherichia coli Rosseta 2 (DE3) Т1R, несущий ген устойчивости к хлорамфениколу. Трансформанты выращивали на специализированной обогащенной среде культивирования ТВ с антибиотиками хлорамфениколом и карбоницилином. На 24-ый ч роста отбирали клетки, разрушали с помощью френч-пресса и анализировали лизаты на SDS-ПААГ – электрофорезе (рис. 8). Проводили анализ продуктов экспрессии с помощью иммуноблотинга c антителами к His-tag.

c:\users\алина\pictures\dd.pngc:\users\алина\pictures\dvd.png

Рис.8. Электрофорез (А) и иммуноблоттинг (Б)клеточных лизатов рекомбинантного штамма E.coli Rosseta pET-LIC/Phy на 24 ч роста. М – маркеры, 1–10 – белковые продукты.

Среди продуктов экспрессии идентифицировали белок, молекулярная масса которого соответствовала 41кДа (рис. 8А). Результаты иммуноблоттинга подтвердили, что среди продуктов экспрессии в лизатах рекомбинантного штамма присутствует белок, содержащий гистидиновые «хвосты» (His-tag). При определении фитат-гидролизующей активности в лизатах мы обнаружили активность 0.2 ед./мг биомассы.

Таким образом, в результате LIC-клонирования гена фитазы B.ginsengihumi М2.11 получили эффективный рекомбинантный штамм E.coli Rosseta pET-LIC/Phy6, продуцирующий фитат-гидролизующий фермент бацилл.



5. Разработка метода очистки бациллярной фитазы

12 литров культуральной жидкости рекомбинантного штамма E.coli Rosseta pET-LIC/Phy6, центрифугировали и получали 37 г клеток. Клетки лизировалии центрифугировали, супернатант использовали для выделения фермента. Для очистки фитазы из клеточных лизатов рекомбинантного штамма использовали прием аффинной хроматографии на колонке с Ni-гранулами, специфически сорбирующими His-tag-последовательности. После проведения аффинной хроматографии максимальный выход по активности фермента составил 56 %, степень очистки белка 150 (табл. 2). Ионообменная хроматография ферментного раствора на Q-сефарозе позволила увеличить степень очистки в 180 раз по сравнению с клеточным лизатом, выход по активности на этой стадии очистки составил 18%. Гель-фильтрация на колонке Sephadex G200 позволила получить хроматографически и электрофоретически гомогенный фермент (рис. 9), в результате чего получили фитазу с удельной активностью 0.2, очищенную в 500 раз с выходом по активности 9%.



Табл.2. Выделение и очистка фитазы B.ginsengihumi М2.11 из клеточных лизатов рекомбинантного штамма E.coli.

Стадия очистки

V, мл

Белок общ., мкг

Общая акт-ть, ед. акт.

Удельная акт-ть, ед./мкг

Степень очистки

Выход, %

По акт.

Клеточный лизат

80

51200

19.2

0.0004

1

100

Аффинная хроматография

12

192

10.8

0.056

150

56.25

Хроматография на Q-сефарозе

2

62.5

4.5

0.072

180

18.2

Хроматография на колонке SephadexG200

0.7

9

1.75

0.2

500

9.1

Использованные нами приемы очистки позволили за 3 стадии получить хроматографически гомогенный препарат фитазы из лизатов рекомбинантного штамма, молекулярная масса белка, определенная по данным электрофореза, составила 41 кДа.

c:\users\алина\pictures\dddxx.png

Рис.9. А - Хроматография фитазы B.ginsengihumiМ2.11 на колонке с Sephadex G200: 1 – А280, 2 - активность фермента; Б – SDS-ПААГ - электрофорез фитазы после хроматографии на Sephadex G200: маркеры молекулярных масс (1), фракция белка после всех стадий очистки (2).



6. Определение первичной структуры фитазы

Первичную структуру очищенной фитазы B.ginsengihumi М2.11 устанавливали с помощью метода MALDI-TOF-масс-спектрометрии (рис. 10). Установлено, что аминокислотная последовательность фитазы полностью соответствует последовательности, конвертированной из последовательности нуклеотидов секвенированного нами гена фитазы B.ginsengihumi М2.11. Последовательность аминокислот фитазы включала 371 а.о., что соответствовало молекулярной массе белка 41 кДа и подтвердило данные, полученные с помощью SDSэлектрофореза. Изоэлектрическая точка фитазы B.ginsengihumi М2.11, установленная на основании структуры белка, составила pI 4.8.

Анализ первичной структуры фитазы B.ginsengihumi М2.11 показал наличие в молекуле белка шести консервативных сайтов связывания с кальцием, три из которых оказывают влияние на термостабильность фермента (Ca1,Ca2, Ca3) и три определяют каталитическую активность белка (Ca4, Ca5, Ca6).

c:\users\алина\pictures\maldi full.png

Рис.10. MALDI-TOF масс-спектрометрия пептидов, полученных в результате обработки фитазы трипсином. Наложение коротких пептидов на основную аминокислотную последовательность фитазы, клонированную в рекомбинантный вектор.

Эти данныесвидетельствуют, что выделенная нами фитаза B.ginsengihumi М2.11 принадлежит к классу бациллярных βпропеллерных фитаз (рис. 11). По данным литературы (Ha N., Nat. Struct. Biol., 2000) первый ион кальция связывается счетырьмя аминокислотными остатками в молекуле белка (Asp292, Asp325, Asn323, Ile324), второйион кальция координирован с остатками Asp292,Asp320 и Glu322, третий – с остатками Asp40, Pro41 и Val85.Остальные три иона кальция занимают сайты сменьшим родством. Четвертый ион кальция ответственен за каталитические свойства белка и координирован с четырьмя аминокислотными остатками: Asp39, Glu195, Asn83, Asn84, пятый ион кальция связан с Glu211, Tyr143, Glu195, Glu244,шестой ион кальция связан с Glu244, Asp242,Gln263 (рис. 11).

Сравнительный анализ первичных структур фитаз бацилл, доступных на сервере Protein Data Bank (http://www.rcsb.org/pdb/explore) и проведенный с помощью сервера UNIPROT (http://www.uniprot.org), подтвердил высокую степень идентичности структур этих ферментов (рис. 11).



c:\users\алина\pictures\выравн крсн.png

Рис.11. Выравнивание аминокислотных последовательностей фитаз бацилл(http://www.pdb.org/pdb) с последовательностью фитазы B.ginsengihumi М2.11,полученной в результате MALDI-TOF масс-спектрометрии(красным цветом окрашены одинаковые остатки). Чернымибоксами выделены аминокислотные остатки, координирующие шесть кальций-связывающих сайтов в структуре молекулы.

На основе первичной структуры фитазы B.ginsengihumi М2.11 с помощью программы Phyre21 (http://www.sbg.bio.ic.ac.uk/phyre2/) мы построили гипотетическую 3D-модель фитазы. Из рисунка 12Б видно, что белковая глобула содержит β-структуры, напоминающие шестилопастной пропеллер, так же как и 3D-модель фитазы B.amyloliquefaciens в мировой базе данных PDB (http://www.rcsb.org/pdb/) (рис. 12А).

c:\users\алина\pictures\3ds.png

Рис.12. 3D-модели (A) - фитазы B.amyloliquefaciens 2POO (Å - Х:50.98 Y:65.15 Z:105.68) и (Б) – фитазы (гипотетическая) B.ginsengihumi М2.11 (Å -X:49.624 Y:50.001 Z:59.096). Цвета радужного градиента обозначают переход от N-концевого (красный) к C-концевому (синий) домену.

Таким образом, полученные данные свидетельствуют, что очищенная фитаза B.ginsengihumi М2.11 принадлежит к классу бациллярных β-пропеллерных фосфатаз, обладающих фитат-гидролизующей активностью.

7. Свойства фитазы


А Б
Определяли рН оптимум и стабильность фитазы. Установлено, что рН-оптимум фитазы в 0.1М натрий ацетатном буфере составляет рН 6.0 (рис. 13А). Белок стабилен в интервале рН от 5.0 до 9.0 (рис. 13Б).
Рис.13. Влияние рН на активность фитазы B.ginsengihumi М2.11. А – Определение рН оптимума фермента; Б – определение рН стабильности фитазы.

При исследовании влияния температуры на активность фитазы B.ginsengihumi М2.11 установлено, что температурный оптимум фермента соответствует 37° С (рис. 14А). Белок проявляет стабильность в интервале температур от 4 до 60° С (рис. 14Б).




А Б

Рис.14. Влияние температуры на активность фитазы B.ginsengihumi М2.11. А – Определение температурного оптимума фермента; Б – определение термостабильности фитазы.

Изучение влияния ионов металлов на активность фитазы показало, что ионы Mn2+, Co2+ и Ca2+ в концентрации 2 мМ повышают активность белка до 20% (рис. 15). Двухвалентные ионы Fe2+, Cu2+ и Zn2+ ингибируют активность фермента в концентрации 2 мМ на 60 - 75%, соответственно, на 20% - ионы Mg2+.
Рис.15. Влияние двухвалентных металлов на активность фитазы B.ginsengihumi М2.11.

Исследовали специфичность фитазы B.ginsengihumi М2.11 по гидролизу ряда субстратов. Установили, что фитаза проявляет специфическую активность по расщеплению фитата натрия и не активна в отношении других фосфатсодержащих субстратов.

Таким образом, фитаза B.ginsengihumi М2.11 активируется на 20% в присутствии ионов Ca2+, Mn2+ и Co2+. Фермент стабилен в диапазоне температур от 4° С до 60° С и при рН от 5.0 до 9.0. Фитаза B.ginsengihumi М2.11проявляет максимальную активность при 37° С, рН 6.0 и отличается узкой субстратной специфичностью.

8. Влияние штамма B.ginsengihumi М2.11 на рост и развитие картофеля

Поскольку штамм B.ginsengihumi М2.11выделен из почвы, мы проводили эксперименты, направленные на выяснение влияния изолята B.ginsengihumi М2.11 на рост растений. В качестве тестового растения использовали картофель. В качестве контроля использовали раствор без добавления штамма-изолята (рис. 16А).



c:\users\алина\pictures\картофель.png

Рис.16. Модельный эксперимент с картофелем. А – контрольный образец, Б – опытный образец под воздействием штамма B.ginsengihumi М2.11.

Растения, обработанные B.ginsengihumi М2.11,отличались от контрольных растений высотой стебля (18±2 против 13±2 мм) и большей биомассой (5.6±0.5 против 2.8±0.5 г). Обработка семян суспензией B.ginsengihumi М2.11 приводила к повышению из всхожести. Таким образом, бактериальный штамм положительно влияет на рост и развитие картофеля.

Определяли токсичность выделенного нами штамма бактерии B.ginsengihumi М2.11. Заражали листья модельного растения Nicotiana tabacum клетками бацилл и фитопатогенных бактерий Xanthomonas sp. Xav5 в качестве положительного контроля (рис. 17). Xanthomonas sp. Xav5 паразитирует на листьях табака и после инъекции внутрь листа развивается инфекционный процесс. В случае, если растение способно отразить влияние посторонней микрофлоры, штамм считается не токсичным.



c:\users\алина\pictures\аиа.png

Рис.17. Инфицирование листьев Nicotiana tabacum штаммами микроорганизмов (А) – введение микроорганизмов в ткань листа; (Б) - листья, инфицированные Xanthomonas sp. Xav5; (В) - листья, инфицированные B.ginsengihumi М2.11.

Установлено, что растительные клетки табака противостояли действию B.ginsengihumi М2.11, в отличие от клеток Xanthomonas sp. Xav5, которые вызывали некрозы ткани. Таким образом, штамм B.ginsengihumi М2.11, продуцент фитазы, после инъекции в растительную ткань не проявлял токсического действия на растение N.tabacum и может быть рекомендован в качестве биотехнологического объекта.

Итак, из разных образцов почв Республики Татарстан нами впервые выделен и идентифицирован штамм B.ginsengihumi М2.11, обладающий фитат-гидролизующей активностью. Ген фермента клонирован и секвенирован. Получен рекомбинантный штамм с высокой экспрессией гена фитазы бацилл. Впервые выделена и очищена внеклеточная фитазаB.ginsengihumiМ2.11 из клеток рекомбинантного штамма, установлена первичная структура белка. Молекулярная масса фермента составила 41 кДа, изоэлектрическая точка pI4.8. Первичная структура фитазы позволила установить ее принадлежность к классу βпропеллерных фосфатаз, термостабильность и активность которых определяется наличием Caсвязывающих сайтов в структуре фермента. Установлено, что фитаза B. ginsengihumi М2.11узкоспецифична, оптимальной температурой для проявления каталитической активности является 37°С, оптимум рН действия равен 6.0, активность фитазы повышается на20% в присутствие ионов Ca2+,Co2+ и Mn2+.Установлено, что штамм B.ginsengihumi М2.11, продуцент фитазы, не обладает токсическим эффектом, стимулирует рост клеток растений и может быть рекомендован для разработки новых сельскохозяйственных биотехнологий на основе фитаз для увеличения урожайности растений.


ВЫВОДЫ

  1. Из образцов почв РТ выделен штамм B.ginsengihumi М2.11, обладающий фитат-гидролизующей активностью.

  2. Ген фитазы клонирован, установлена его нуклеотидная последовательность; получен рекомбинантный штамм с эффективной экспрессией фитазы B.ginsengihumiМ2.11.

  3. Разработан метод выделения и очистки фитазы B.ginsengihumi М2.11 из клеток рекомбинантного штамма на основе аффинной хроматографии, установлена первичная структура фермента, фитаза является узкоспецифичной β-пропеллерной фосфатазой с изоэлектрической точкой pI 4.8. и молекулярной массой 41кДа.

  4. Штамм B.ginsengihumi М2.11 – продуцент фитазы – не обладает токсичностью по отношению к растениям табака и стимулирует рост и развитие картофеля.

Список работ, опубликованных по теме диссертации

  1. Ахметова А.И. Выделение и характеристика новой фитазы бацилл / А.И. Ахметова, Ч. Нямсурен, Н.П. Балабан, М.Р. Шарипова // Биоорганическая химия. - 2013. – Т.39, № 4. – С.430–436. (перечень ВАК) - автора – 0.2 пл.

  2. Ахметова А.И. Влияние клеточной магнетизации на рост и физиологические функции бацилл / А.И. Ахметова, Е.О. Михайлова, Р.Ф. Фахруллин, М.Р. Шарипова // Вестник Казанского технологического университета. - 2013. – №19. – С.203-207. (перечень ВАК) автора – 0.1 пл.

  3. Тойменцева А.А. Штаммы Bacillus pumilus с инактивированными генами внеклеточных сериновых протеиназ / А.А. Тойменцева, А.И. Ахметова, М.Р. Каримова, Ч. Нямсурэн, Ю.О. Пономарева, Е.И. Шагимарданова, А.А. Ризванов, М.Р. Шарипова // Микробиология. – 2013. – Т.82, №1. – С.59. (перечень ВАК) автора – 0.2 пл.

  4. Ахметова А.И. Фитазы как основа новых микробных технологий в кормлении животных / А.И. Ахметова, А.Д.Мухаметзянова, М.Р. Шарипова // Учен. зап. Казан. ун-та. Сер. Естеств. науки. – 2012. – Т. 154, кн. 2, - С. 103-110. (перечень ВАК) автора – 0.2 пл.

  5. Мухаметзянова А. Д. Микроорганизмы как продуценты фитаз / А.Д. Мухаметзянова, А.И. Ахметова, М.Р. Шарипова // Микробиология. - 2012. - Т. 81, № 3. - С.1-10. (перечень ВАК) автора – 0.2 пл.

  6. Шарипова М. Р. Новое филогенетическое положение штамма Bacillus intermedius 3-19 / М.Р. Шарипова, А.А. Тойменцева, А.Р. Сабирова, А.Д. Мухаметзянова, А.И. Ахметова, А.М. Марданова, Н.П. Балабан // Микробиология. - 2011. Т.80, №3. - С.424-426. (перечень ВАК) автора – 0.1 пл.

  7. Мухаметзянова А.Д. Изоляция и идентификация продуцентов фитаз, выделенных и образцов почв Республики Татарстан / А.Д. Мухаметзянова, А.И. Ахметова, М.Р. Шарипова // Казанская наука. – 2010. - №12. - С.24-28. (перечень ВАК) автора – 0.1 пл.

  8. Мухаметзянова А.Д. Фитаза микроорганизмов как основа новых биоудобрений для улучшения роста растений / А.Д. Мухаметзянова, А.И. Ахметова, М.Р.Шарипова // Казанская наука. – 2010. - №1. - С.11-13. (перечень ВАК) автора – 0.1 пл.

  9. Akhmetova А. Phytase of Bacillus sp. M2.11: clonning, expression and purification / А. Akhmetova, М. Sharipova // FEBS Journal. – 2013. - V. 280. Suppl. 1. – P. 609.

  10. Chuluuntsetseg N. Development of transgenic Arabidopsis thaliana plants expressing a root-specific phytase of microbial origin / N. Chuluuntsetseg, L. Valeeva, A. Akhmetova, A. Suleymanova, N. Balaban, E. Shakirov, M. Sharipova // FEBS Journal – 2013. - V. 280, Suppl. 1. – P. 602.

  11. Ахметова А.И. Лигазо-независимое клонирование. Учебно-методическое пособие / А.И. Ахметова, М.Р. Шарипова. – Казань: Казанский (Приволжский) федеральный университет, 2013. – 14с.

  12. Ахметова А.И. Выделение и очистка новой фитазы бацилл / А.И.Ахметова, М.Р. Шарипова // Материалы VI Российского Симпозиума «Белки и Пептиды». Уфа: 2013. - С. 257.

  13. Ахметова А.И. Получение рекомбинантного штамма Escherichia coli, способного к гиперпродукции фитазы бацилл // Материалы XX Международной молодежной научной конференции студентов, аспирантов и молодых ученых «Ломоносов», секция «Биоинженерия и биоинформатика». Москва: 2013. - С.1-2.

  14. Нямсурэн Ч. Гетерологичная система экспрессии генов в растениях на основе гена бациллярной фитазы / Ч. Нямсурэн, Л.Р. Валеева, А.И. Ахметова, А.Д. Сулейманова, Н.П. Балабан, Е.В. Шакиров, М.Р. Шарипова // Материалы Всероссийской научной конференции с международным участием «Инновационные направления современной физиологии растений». Москва: 2013. - С. 212-213.

  15. Нямсурэн Ч. Гетерологичная система экспрессии генов на основе гена фитазы бацилл / Ч. Нямсурэн, Л.Р. Валеева, А.И. Ахметова, А.Д. Сулейманова, Н.П. Балабан, Е.В. Шакиров, М.Р. Шарипова // Сборник тезисов.17-я Международная Пущинская школа-конференция молодых ученых «Биология – наука XXI века». Пущино: 2013. – С. 368-359.

  16. Нямсурэн Ч. Получение трансгенных растений Arabidopsis thaliana, секретирующих микробную фитазу phyCg Bacillus ginsengihumi / Ч. Нямсурэн, Л.Р. Валеева, А.И. Ахметова, А.Д. Сулейманова, Н.П. Балабан, Е.В. Шакиров, М.Р. Шарипова // Материалы XIII молодежной научной конференции «Биотехнология в растениеводстве, животноводстве и ветеринарии». Москва: 2013. – С.39.

  17. Ахметова А.И. Фитазы – микробные ферменты современной биотехнологии // Материалы XIX Международной молодежной научной конференции студентов, аспирантов и молодых ученых «Ломоносов», «Биоинженерия и биоинформатика». Москва: 2012. - С.1-2.

  18. Ахметова А.И. Фитазы бацилл в повышении эффективности кормления животных / А.И. Ахметова, М.Р. Шарипова // Материалы открытого конкурса научных работ студентов и аспирантов им. Н.И.Лобачевского. Казань: 2012, - С.42.

  19. Ахметова А.И. Фитазы бацилл в повышении эффективности кормления животных // Материалы открытого конкурса научных работ студентов и аспирантов им. Н.И.Лобачевского. Казань: 2012. - С.317.

  20. Akhmetova A.I. Bacillary phytase as a basis of effective animal feed / A.I. Akhmetova, M.R. Sharipova // Materials of XVI Symposium of Biology Students in Europe “SymBioSE 2012”, Szeged and Godollo, Hungary: 2012. - P.59.

  21. Ахметова А.И. Фитазы бацилл в повышени эффективности кормления животных / А.И. Ахметова, М.Р. Шарипова // Материалы XI научной конференции молодых ученых, аспирантов и студентов научно-образовательного центра Казанского (Приволжского) федерального университета «Материалы и технологии XXIвека». Казань: 2012. - С.14.

  22. Ахметова А.И. Клонирование и секвенирование гена
    фитат-гидролизующего фермента Bacillusginzengihumi / А.И. Ахметова, М.Р. Шарипова // Материалы международной конференции "Биология -  наука XXI века". Москва: 2012. - С.75.

  23. Akhmetova A.I. Identification of bacterias with high phytate degrading activity / A.I. Akhmetova, A.D. Mukhametzyanova, M.R. Sharipova // Materials of XV Symposium of Biology Students in Europe “SymBioSE 2011”, Basel, Switzerlan: 2011. - P.9.

  24. Mukhametzyanova A.D. Characterization of B.subtilis strain with the knocked-out phytase gene / A.D. Mukhametzyanova, I.I. Marenova, A.I. Akhmetova, M.R. Sharipova // Materials of XV Symposium of Biology Students in Europe “SymBioSE 2011”, Basel, Switzerland: 2011. - P.39.

  25. Akhmetova A. Identification of bacterias with high phytate degrading activity / A.I. Akhmetova, M.R. Sharipova // Materials of III Annual International Scientific Conference in Biology, Tblisi, Georgia: 2011. – P.57.

  26. Ахметова А.И. Изоляция бактерий с высоким уровнем секреции фермента, гидролизующегофитат / А.И. Ахметова, А.Д. Мухаметзянова, М.Р. Шарипова // Материалы Российской школы молодых ученых «Актуальные проблемы современной биохимии и молекулярной биологии». Казань: 2010. - С. 11.

  27. Мухаметзянова А.Д. Идентификация продуцентов фитаз, выделенных из образцов почв Республики Татарстан / А.Д. Мухаметзянова, А.И. Ахметова, М.Р. Шарипова // Материалы Российской школы молодых ученых «Актуальные проблемы современной биохимии и молекулярной биологии». Казань: 2010. - С. 42.

  28. Mukhametzyanova A.D. Phytases of microorganisms – the basis of new biofertilizers for plants’ growth promotion / A.D. Mukhametzyanova, A.I. Akhmetova, M.R. Sharipova // Materials of Theoretical and practical biochemists’ conference devoted to the memory of Prof. V.G. Vinter “History and Achievements of Kazan University Biochemistry School”. Kazan: 2009. – P. 88.

E-mailавтора: akhmetova.alina@gmail.com


Просьба высылать отзывы на автореферат по адресу: 420008, г. Казань, ул. Кремлевская, д. 18, главное здание КФУ, отдел аттестации научно-педагогических кадров, Ученому секретарю Диссертационного совета Д 212.081.08 д.б.н., проф. Абрамовой Зинаиде Ивановне., факс: (843) 238-76-01. E-mail: ziabramova@mail.ru
Каталог: portal -> docs
docs -> Статьи, опубликованные в 2014 году в журналах, индексируемых в scopus
docs -> Лекция Межкультурная компетентность педагога в поликультурной образовательной среде: структурная и уровневая характеристики
docs -> План заседаний Ученого совета ифмб на 2015-16 уч г. Утвержден на заседании Ученого совета ифмиБ
docs -> Ономатопея в современном английском, русском и немецком языках
docs -> Информация о сотрудниках института, у которых истекает срок трудового договора или пятилетний срок проведения конкурса на должность научно-педагогического работника
docs -> Методическая разработка по дисциплине «Статистика» для проведения семинарских, практических, лабораторных занятий и самостоятельной работы
docs -> Иосиф волоцкий в отечественной историографии XIX xx вв. 07. 00. 09 Историография, источниковедение и методы исторического исследования


Поделитесь с Вашими друзьями:


База данных защищена авторским правом ©uverenniy.ru 2019
обратиться к администрации

    Главная страница