Рост растяжением и водный обмен в условиях дефицита воды




страница1/4
Дата14.07.2016
Размер0.5 Mb.
  1   2   3   4



На правах рукописи

ВЕСЕЛОВ ДМИТРИЙ СТАНИСЛАВОВИЧ

РОСТ РАСТЯЖЕНИЕМ И ВОДНЫЙ ОБМЕН В УСЛОВИЯХ

ДЕФИЦИТА ВОДЫ

Специальность 03.00.12 – Физиология и биохимия растений

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук


Уфа-2009

Работа выполнена в Лаборатории физиологии растений

Учреждения РАН Института биологии Уфимского научного центра РАН

Официальные оппоненты: Вахитов Винер Абсатарович

доктор биологических наук, профессор

Титов Александр Федорович

доктор биологических наук, ч-кор РАН, профессор



Хайруллин Рамиль Магзинурович

доктор биологических наук, профессор


Ведущая организация – С-Петербургский госуниверситет


Защита состоится «19 » ноября__ 2009 г. в 1400 часов на заседании диссертационного совета Д 212.013.11 в ГОУ ВПО Башкирский государственный университет по адресу: 450074, г. Уфа, ул. Заки Валиди, 32, биологический факультет БашГУ, ауд. 332.

Факс (347) 273-67-78, email: disbiobsu@mail.ru

Официальный сайт БашГУ: http://www.bashedu.ru/firstbgu_r.htm
С диссертацией можно ознакомиться в библиотеке ГОУ ВПО Башкирский государственный университет.

Автореферат разослан «____»________________2009 г.


Ученый секретарь

диссертационного совета, д.б.н. М.Ю. Шарипова



ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы исследования. Недостаток воды в почве и воздухе, засоление и присутствие в почве ионов тяжелых металлов - наиболее распространенные неблагоприятные абиотические факторы окружающей среды, которые создают угрозу жизни растений, тормозят их рост и снижают урожайность. Общим для данных факторов является то, что они нарушают водный обмен растений и вызывают торможение роста растяжением поделившихся клеток. Вместе с тем, было показано, что при резком возрастании дефицита воды вслед за торможением роста происходит его возобновление, что является важным свойством растений, обеспечивающим их выживание (Serpe, Matthews, 1992; Salah, Tardieu, 1996; Кудоярова и др., 1998; Munns et al., 2000).

Хорошо известно, от чего зависит растяжение клеток (Cosgrove, 2000; Шарова, 2004). Это осмотический потенциал и тургор, растяжимость клеточной стенки и доступность воды для роста. Гораздо меньше сведений о роли каждого из них в приспособлении процесса роста растяжением к условиям обитания растений (Nonami, Boyer, 1999), и особенно скудна информация о механизмах быстрого реагирования на внезапные изменения окружающей среды (Serpe, Matthews, 1992, Hsiao et al., 1998; Munns et al., 2000). Необходимо было также понять, как осуществляется регуляция быстрых ростовых реакций. В литературе много внимания уделяется сигнальной роли гормонов в реакции на внешние воздействия (Шакирова, 2001; Титов и др., 2006). Существует мнение, что быстрые ростовые реакции в ответ на засоление не связаны с гормонами (Munns et al., 2000). Тем не менее, некоторые воздействия уже через несколько минут вызывали изменения концентрации гормонов в растениях (Кудоярова и др., 1999), что привлекает интерес к изучению возможной роли гормонов в обеспечении быстрых адаптивных реакций у растений. Много внимания уделяется роли абсцизовой кислоты (АБК) в качестве корневого сигнала, продуцируемого корнями в неблагоприятных условиях (Davies et al., 2005). Наряду с корневой АБК, важную роль при дефиците воды может играть абсцизовая кислота, синтезируемая в самом листе (Popova et al., 2000). Серьезным пробелом в этой области является отсутствие сведений о том, в какой части листа может запускаться синтез АБК в ответ на водный стресс (Meinzer, 2000).

Закрытие устьиц не только способствует поддержанию водного баланса при дефиците воды, но и потенциально может снижать пассивный приток токсичных ионов в растение с транспирационным потоком. Вместе с тем, сведения о связи скорости транспирации с действием на растение токсичных ионов противоречивы (James et al., 2008), что указывает на необходимость дальнейших исследований в этой области.

С открытием водных каналов аквапоринов не утихают дискуссии об их роли в регуляции транспорта воды в растении (Trofimova et al., 2003; Sade et al., 2009; Parent et al, 2009). По некоторым данным, повышение их активности способствует возрастанию засухоустойчивости, а по другим – ее снижению (Aroca et al., 2005). Само существование противоположных точек зрения по данному вопросу указывает на актуальность изучения участия водных каналов в регуляции гидравлической проводимости на уровне целого растения и ее роли в поддержании водного обмена при дефиците воды.



Цель данной работы - выявить механизмы, обеспечивающие регуляцию роста растяжением и водного обмена у злаковых растений при действии внешних факторов, вызывающих дефицит воды. Для ее решения были поставлены следующие задачи:

  1. Изучение способности растений поддерживать рост и оводненность при воздействиях, повышающих дефицит воды в растениях: осмотическом шоке, засолении, неоптимальной температуре и действии тяжелых металлов.

  2. Исследование роли осмотической регуляции в возобновлении роста и его поддержании при дефиците воды, вызванном действием непроникающих осмотически активных веществ и засолением.

  3. Оценка характера и степени изменения растяжимости листьев при осмотическом стрессе и возможной роли экспрессии генов экспансинов как фактора, определяющего скорость роста растяжением при внешних воздействиях.

  4. Сравнительное изучение динамики эндогенных гормонов и скорости роста растений при стрессе с целью выявления возможной роли гормонов в регуляции быстрого ростового ответа на внешние воздействия.

  5. Выявление степени влияния устьичной проводимости на оводненность листьев и поддержание ростовых процессов при возрастании дефицита воды, а также возможности быстрого накопления АБК как фактора, обеспечивающего закрытие устьиц.

  6. Сравнительное изучение влияния кратковременного и длительного засоления на устьичную проводимость растений, различающихся по солеустойчивости.

  7. Выявление зависимости уровня накопления токсичных ионов от скорости транспирации путем сравнения этих показателей у растений, различающихся по солеустойчивости.

  8. Изучение влияния осмотического стресса на содержание аквапоринов, экспрессии их генов и сопоставление этих показателей с гидравлической проводимостью растений и изменением скорости транспирации.

Основные положения диссертации, выносимые на защиту:

Восстановление водного баланса и роста достигается как за счет закрытия устьиц, так и повышения гидравлической проводимости. Выбор между этими альтернативными механизмами зависит от места накопления АБК в растении: увеличение содержания в листьях обеспечивает закрытие устьиц, в корнях – повышение гидравлической проводимости.

Быстрое возрастание растяжимости листа связано с накоплением ИУК и повышением экспрессии генов экспансинов и способствует поддержанию роста при осмотическом стрессе. Отсутствие возрастания растяжимости листа при засолении является признаком низкой солеустойчивости.

Снижение скорости транспирационного потока уменьшает поступление и накопление токсичных ионов при кратковременном засолении.

Закрытие устьиц повышает устойчивость растений только в первое время действия на растения дефицита воды и засоления, а при их более продолжительной экспозиции устойчивость зависит от способности растений поддерживать устьица открытыми.

Изменение гидравлической проводимости растения зависит от уровня экспрессии генов аквапоринов в клеточных мембранах корней.



Научная новизна. Выявлено, что повышение осмоляльности клеточного сока начинается после первого часа осмотического стресса, что происходит не за счет снижения оводненности тканей, а за счет активного накопления осмотически активных веществ. Впервые показано значение быстрого (в течение первых минут действия стрессовых факторов) закрытия устьиц в возобновлении роста и поддержании оводненности листьев при резком возрастании дефицита воды. Установлено, что сигналом для снижения устьичной проводимости является повышение уровня АБК, которое становится заметным уже через 10 минут после начала действия стресса. Наибольшее возрастание концентрации абсцизовой кислоты обнаружено в зоне роста листьев однодольных растений, где происходит сжатие клеток. С помощью метода иммунолокализации выявлено накопление АБК при засолении в области устьичных клеток. Впервые показано увеличение коэффициента растяжения листа параллельно с накоплением ИУК на протяжении 40 минут осмотического стресса, что способствует поддержанию роста листьев и обусловлено возрастанием экспрессии гена экспансина альфа Exp1. Сравнение реакции на засоление и действие нейтрального непроникающего осмотика ПЭГ у относительно солеустойчивых растений ячменя и чувствительных к засолению растений пшеницы позволило впервые выявить быстрые проявления токсического (ион-специфического) компонента уже в течение первого часа действия засоления. Обнаружено противоположное действие осмотического стресса на уровень экспрессии генов аквапоринов у растений ячменя и кукурузы, что связано с различным вкладом апопластного пути транспорта воды у растений этих видов.

Научно-практическая значимость работы. Выявлены основные механизмы поддержания роста и оводненности растений в условиях возрастания дефицита воды за счет быстрого снижения устьичной и возрастания гидравлической проводимости растений, накопления осмотически активных веществ и повышения растяжимости листа, что имеет важное значение для понимания процессов, обеспечивающих получение стабильного урожая в изменяющихся условиях обитания. Выявленные в начале действия засоления различия в ростовой реакции у растений с разным уровнем устойчивости могут быть использованы для разработки биотеста для ее ранней диагностики у растений. Показана также перспективность использования показателей устьичной реакции растений на кратковременное действие засоления как физиологического признака в селекции на солеустойчивость. Основные результаты работы используются при обучении студентов кафедры физиологии растений (включены в учебное пособие «Гормоны и адаптация растений к условиям обитания»).

Связь работы с плановыми исследованиями и научными программами. Исследования проводились в рамках планов НИР лаборатории физиологии растений Института биологии УНЦ РАН: «Оптимизация и стабилизация продукционного процесса растений в условиях стресса уровнем минерального питания и регуляторами роста» (1996-1998), «Исследование системы регуляции концентрации фитогормонов как фактора интеграции растительного организма» (1999-2003), «Механизмы передачи сигналов между органами растения и согласования процессов, обеспечивающих рост и водный обмен в изменяющихся условиях внешней среды» (2004-2006), «Регуляция роста и водного обмена растений в изменяющихся условиях внешней среды» (2007-2009).

Декларация личного участия. Автором была определена тема исследования и проведен подбор экспериментальных моделей. Часть результатов, представленных в 3.1-3.3 главах диссертации получены в совместной работе с к.б.н. Г.Р. Ахияровой, к.б.н. И.Б. Сабиржановой и к.б.н. Г.В. Шариповой. Автор был научным руководителем их диссертаций. Автору принадлежит замысел и окончательный текст диссертации. В диссертации использованы работы, опубликованные в соавторстве.

Апробация работы. Материалы диссертации были представлены на 20 конференциях, наиболее важные из которых: III, IV, VI съезд обществ физиологов растений (Москва, 1997; Москва, 1999; Сыктывкар 2007), XI-XIV конгрессы европейских обществ физиологов растений (Варна, 1998; Будапешт, 2000; Крит, 2002; Краков, 2004), 5-й междунар. симпозиум общества по изучению корней растений (Южная Каролина, 1998), 5-й междунар. симпозиум по структуре и функции корней (Словакия, 1998), 3-я всеросс. конф. «Иммуноанализ регуляторов роста в решении проблем физиологии растений, растениеводства и биотехнологии» (Уфа, 2000), межд. конф. «Environmental Stress and Sustainable Agriculture» (Варна, 2002), 5-я экологическая конф. (Казань, 2002), Межд. симпозиум «Сигнальные системы растений: роль в адаптации и иммунитете» (Казань, 2006), Всеросс. конф. «Биомика – наука XXI века» (Уфа, 2007), Междунар. конф. «Физико-химические основы структурно-функциональной организации растений» (Екатеринбург, 2008). 

Исследования были выполнены при поддержке грантов РФФИ № 97-04-49962, № 99-04-49291, № 02-04-97908-р2002агидель; № 03-04-49780; № 06-04-49166; № 06-04-49276, персональных грантов Президента РФ № МК-7418.2006.4 и «Фонда содействия отечественной науке» по программе «Молодые кандидаты и доктора наук РАН»; программ ГНТП АН РБ.



Публикации. По теме диссертации опубликованы 42 работы, в том числе 1 монография, 19 статей в научных журналах, рекомендованных ВАК РФ для защиты докторских диссертаций, 12 статей в крупных региональных изданиях, 1 патент.

Структура и объем работы. Диссертация изложена на 283 страницах машинописного текста (включая иллюстрации и список литературы) и состоит из введения, обзора литературы, 4 глав экспериментальной части, заключения и выводов. В работе представлено 12 таблиц и 77 рисунков. Список литературы включает 408 наименований, из них 357 иностранных.

Благодарности. Автор благодарит к.б.н. Ахиярову Г.Р., к.б.н. Сабиржанову И.Б., к.б.н. Шарипову Г.В. за помощь в сборе и обработке материала, к.б.н. Высоцкую Л.Б., д.б.н. Трапезникова В.К. за ценные советы и рекомендации, д.б.н. Кудоярову Г.Р. за чуткое руководство и предоставление всех необходимых условий для выполнения экспериментов и весь замечательный коллектив нашей лаборатории за всестороннюю поддержку и помощь. А также жену и родителей за чуткость, помощь и понимание.

ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЙ

Исследования проводили на растениях ячменя (Hordeum vulgare: сорта Golf, Михайловский и Прерия и дефицитных по АБК мутантных растений Az34; Hordeum spontaneum: линии Т-1 и 20-45), яровой твердой пшеницы (Triticum durum, сорта Безенчукская 139), яровой мягкой пшеницы (Triticum aestivum, сорта Казахстанская 10, Ирень) и кукурузы (Zea мays, гибрид Харьковский 310 МВ и линия B73) в лабораторных условиях на водной культуре. Растения ячменя линии T-1 были получены из популяции, отобранной в Турции, а 20-45 – в Израиле (Nevo et al. 1986). Эти линии были отобраны как морфологически сходные, но имеющие контрастную устойчивость к засолению по предварительным данным, полученным в опытах в гидропонической культуре.

Семена проращивали в темноте в течение 2-3 суток на дистиллированной воде с добавлением 10-5 M CaCl2, при температуре 24˚ С. На четвертые сутки проростки пересаживали на 10 %-ную среду Хогланда-Арнона-I и выращивали при освещенности 18000 лк и 14-часовой продолжительности светового дня. Опыты в основном проводили с растениями, у которых активно рос первый лист. В более длительных опытах растения переносили на 100 %-ную среду Хогланда-Арнона.



Температуру воздуха повышали на 4+1оС за несколько минут потоком горячего воздуха от тепловентилятора “Ветерок-2” и поддерживали на постоянном уровне в течение 1,5 ч. Действие нейтрального осмотика ПЭГ 6000 изучали путем его добавления в питательную среду до конечной концентрации 12 %, что соответствует осмотическому потенциалу -0,73 МПа. Засоление вызывали внесением в питательную среду хлорида натрия до конечной концентрации 100 мМ.

Рост растений регистрировали с помощью датчика роста на основе линейного дифференциального трансформатора с подвижным сердечником ДЛТ-2. Для измерения растяжимости листа дополнительный груз массой 2 г подвешивали к коромыслу датчика роста со стороны сердечника. Коэффициент растяжения (m) рассчитывали по формуле (Thomas et al, 1999): m=(Х10)/(Lgr * ) (сек-1* Па), где - Х0 (м/сек)- скорость роста без груза, Х1 (м/сек)- стабильная скорость роста после добавления груза, Lgr (м) - длина зоны растяжения листа,  - изменение тянущего усилия.

Транспирацию определяли весовым методом. Для измерения устьичного сопротивления был использован порометр (MK Delta-T). Осмотическое давление в ксилемном соке и соке, отжатом из тканей растений определяли на цифровом микроосмометре (CAMLAB Limited, UK) по температуре замерзания. Относительное содержание воды определяли в дифференцированной части листа по формуле: ОСВ=100%х(сырой вес–сухой вес)/(тургорный вес–сухой вес).

Гидравлическую проводимость корня рассчитывали по формуле Lp=V/(πx – π0), где Lp – гидравлическая проводимость; V – поток воды из корней; πx – осмотическое давление пасоки; π0 – осмотическое давление питательной среды.

Концентрацию ионов натрия и калия в клеточном соке определяли с помощью пламенно-жидкостного хроматографа PHP7 (JENWAY Великобритания), ионов хлора - с помощью метода капиллярного электрофореза на ионном анализаторе «Нанофор 01».

Содержание хлорофиллов a и b определяли спектрофотометрически в аликвоте 96% этилового спирта, полученной из навески побегов. Расчет вели по формулам Реббелена (Методы биохимического анализа, 1978). Скорость фотосинтеза измеряли с помощью газового анализатора CIRAS 1 (PP Systems, Hitchin, Herts, UK).

Для определения содержания гормонов в тканях растительный материал гомогенизировали и экстрагировали 80%-ным этанолом. Спиртовой экстракт отделяли центрифугированием и упаривали до водного остатка. Ксилемный сок для определения гормонов собирали, как описано (Vysotskaya et al., 2004). Очистку АБК и ИУК проводили по модифицированному экстракционному методу (Veselov et al., 1992). Цитокинины разделяли с помощью ТСХ как описано (Kudoyarova et al., 1998). Иммуноферментный анализ и иммунолокализацию проводили с помощью специфических антител к гормонам (Веселов, 1998), активность цитокининокидазы – как описано (Веселов, Симонян, 2004).

Транскрипционную активность гена экспансина оценивали с помощью метода дот-блот анализа (Sabirzhanova et al., 2005) в гибридизационной камере Micro-4 (Hybaid) при 65 °C. Фрагмент 3'-UTR гена alpha-expansin 1 (α Expa1) использовали в качестве специфической гибридизационной пробы (Wu et al., 2001). Его амплифицировали с помощью ПЦР, используя праймеры Exp1 For 5' CTACTACTACTCCATCGACG 3' и Exp1 Rev 5' ATTAAGTTGCACGACACC 3' [Wu et al., 2001]. Синтез равномерно меченной пробы ДНК проводили с использованием упомянутых выше праймеров в присутствии [α-32P] дЦТФ (Feinberg et al., 1983).

Для выявления гена аквапорина ячменя HvPIP2;4 использовали следующие праймеры: For: ggcttcgcggtgttcatg; Rev: ggccttctcgttgttgtagatca and 26S rRNA (For: gaagagccgacatcgaagga; Rev: gaaaagttcccacagggataactg), подобранные для соответствующей 3’-нетранслируемой области. Реакционная смесь для ПЦР реакции: QuantiTect SYBR Green PCR Master Mix (Qiagen), 1 мкM каждого праймера, 5 нг кДНК в объеме 25 мкл. РТ-ПЦР в реальном времени проводили с помощью ABI PRISM7700 (Applied Biosystems), сначала при 95°C в течение15 мин, за которым следовало 40 циклов (95°C, 15 сек; 58°C, 30 сек; 72°C, 30 сек). Относительную количественную оценку проводили с использованием 26S rRNA для нормализации выхода РНК как описано (PE Applied Biosystems (2001) User Bulletin#2).

Определение транскрипционной активности генов ZmPIP проводили как описано (Chaumont et al., 2001).

Статистическую обработку проводили по стандартным программам.
  1   2   3   4


База данных защищена авторским правом ©uverenniy.ru 2016
обратиться к администрации

    Главная страница